The Ever Changing Concept of the Gene

 

It is common knowledge not just among biologists today but also to the lay public with some scientific  knowledge and also schoolchildren that DNA is the basis of all genes and that genes contain the information for how organisms are made and how they will survive but consider this: prior to 1953, only a few scientists were aware that although genes carried heritable information and even though after 1944, it was discovered that genes are composed of nucleic acids mainly DNA but how genes were structured and how their structure related to their function was only discovered after James Watson and Francis Crick both unraveled the structure of DNA revealing it to be a double helix and showing that of all the molecules that are found in nature, DNA , as a double helix, has the ability to store biological information, but is capable of replication.

 

Ever since that kind of scientific breakthrough, which leads to even more investigations, the gene is defined as a molecule of DNA that expresses biological information in the form of proteins and that all of genes in all life forms replicate carrying information from one generation to the next.

 

The fact that genes are made of DNA and replicate is an example of how science progresses, sometimes at first the initial discovery of what is called genetics, a subfield of biology that studies heredity was at first not recognized but when the time is right, and when biologists begin to realize that what was then a new subfield of biology worthy of investigation and for solving previous problems in biology, there was and still is great potential for understanding that one aspect of nature and that is the living world, how life evolves and carries its information from one generation to the next and how that it can benefit society from medicine to agriculture, rests on one concept, the gene, and what I intend to argue is that the same concept , which is the gene, from something abstract to real can change as new discoveries were made and how discoveries can broaden, and revise the concept which was put forth to explain the process of heredity or in other words how the concept of genes changes as science progresses.

 

                                                                                                                                                                                                                               Darwin’s Dilemma

 

The science of heredity was placed on a firm scientific foundation starting with a revolution that began in 1859 with the publication of The Origin of Species by English naturalist, Charles Darwin. He clearly  explains that all of life is never static but because of changes in habitat, evolve into new forms capable of adapting to new changes in their habitats and it was Darwin who gave the name for the mechanism that results in the evolution of life, natural selection. Through natural selection,  whatever change that occurs in an individual whether the presence of a thick fur coat in a new generation of mammals in a habitat that has become cold where previously it was warm or flowers with bright petals that exude scent to attract insects where previously the generation had flowers that did not release scent and had little success in attracting pollinating insects, any change that occurs however small will benefit the organisms allowing survival and each organism with their new function and structure will pass it on their progeny and through reproduction, changes that are either beneficial will increase the chance of survival while harmful changes will likely kill the organism.

 

It was Darwin who not only defined natural selection for the mechanism that results in evolutionary change but more importantly his genius was the realization of population thinking where in a population, no two individuals are alike and that makes a difference in survival which ultimately results in evolution.

 

There was one problem that Darwin was aware. For natural selection and hence evolution to occur, there must be variation of some sort in a population for without variation, there can be nothing for natural selection to work on so through reproduction, a change , or mutation, can result that neither harms nor helps an organism in its habitat or if the mutation is beneficial, not only will the organism survive but will pass on that survival conferring trait to its offspring and through time, the population will evolve possibly resulting in new species. The problem was that Darwin did not know anything about genetics and he was ignorant of genes so he was not afraid to admit his ignorance of where the source of variation came from. Darwin (1859) stated ” Our ignorance of the laws of variation is profound. Not in one case out of a hundred can we pretend to assign any reason why this  or that part differs, more or less, from the same part in the parents.” (p. 127). Although Darwin was ignorant of genetics, since that science did not existed prior to 1865 but Darwin knew that for natural selection to work, there had to be heritable variation in any population, which Darwin (1859) clearly stated, in addition to his ignorance of genetics ” But whenever we have the means of instituting a comparison, the same laws appear to have acted in producing the lesser differences between varieties of the same species, and the greater difference between species of the same genus.” (pg. 127). Variation is present in populations but exactly how it occurs was unknown until around 1865, a long term experiment with pea plants was carried not by a scientist but a monk with an interest in biology and his name was Gregor Mendel.

 

                                                        Peas Provide the Clues

 

Gregor Mendel was an Austrian monk who was well known for his long term experiment with pea plants. From 1857 to 1865, Mendel did careful breeding of pea plants in order to determine what principles if any were responsible for variation in generations of pea plants and the traits he observed were tallness or shortness of plant, texture of seeds, flower color, purple or white, amongst other traits. The experiments revealed a pattern of inheritance and it turns out that each trait is inherited separately. There are no blending of traits but each trait is inherited from each parent. This was observed in what are called true breeding lines or plants mated with the same traits such as a purple flower plant crossed with a purple flower plant to give offspring with purple flowers. When plants with the same characteristics are crossed that is when pollen, is transferred to the ovum , and if the pollen came from a plant with purple flowers and is transferred to the ovum of a plant with purple flowers then the offspring will have flowers with purple flowers and likewise with white flowers the offspring will have white flowers. This was found by Mendel as part of his long term experiment with pea plants.

 

What would happen if pollen from a purple flower plant is transferred to a plant with white flowers. Would there be mixing of colors resulting in pink flowers or when a tall pea plant is crossed with a short pea plant would the resulting offspring have a height halfway between a tall and short plant? Mendel did the cross breeding experiment and the result is that there were no mixing of colors in the offspring and also no intermediate heights in the offspring. One trait appeared in the first generation that was the same in one of the parents that is the first generation of progeny had all purple flowers so it seemed that the other trait, white flowers, disappeared but did it disappear completely or was the trait for white flowers still present but in another generation would the white flower color appear? Mendel breed seeds from the first generation then carried out the process of growing pea plants which became the second generation and indeed, the second generation in addition to purple flowers there were plants with white flowers so the trait of white petal color did not disappear but reappear in the second generation.

 

 

A pea plant. Studies of how traits are inherited through the pea plant revealed that there are two or more traits carried on each gene called alleles and through alleles a population of organisms such as the pea plants are not only inherited but in each generation whatever traits appear will either allow the plant to survive or perish. Variations are present and was studied by Gregor Mendel which is the basis of genetics or the study of biological heredity. Darwin postulated that variations are present in populations but it was through the Modern Synthesis of the 1940's that a combination of Darwin and Mendel gave a firm foundation to evolutionary biology.

A pea plant. Studies of how traits are inherited through the pea plant revealed that there are two or more traits carried on each gene called alleles and through alleles a population of organisms such as the pea plants are not only inherited but in each generation whatever traits appear will either allow the plant to survive or perish. Variations are present and was studied by Gregor Mendel which is the basis of genetics or the study of biological heredity. Darwin postulated that variations are present in populations but it was through the Modern Synthesis of the 1940’s that a combination of Darwin and Mendel gave a firm foundation to evolutionary biology.(Michael MK Khor)

 

Two traits such as flower color can either be inherited from parent or offspring but if one is present in the parent then the offspring will inherit only one trait while the other trait is hidden only to reappear in another generation. In genetics a trait or phenotype that is present in each generation suppressing the other trait is known as the dominant trait and purple petals are dominant in that this kind of flower color is present in all generations whereas the white flower petals are recessive which would be hidden since the purple flower petals are expressed in each individual plant but in the next generations reappears.

 

From these careful breeding experiments, Mendel ruled out what was called blending inheritance or the belief that traits from parents are blended into the offspring. If it was true then there would be no variation in future offspring and with no variation then there would be nothing for natural selection to act on. One can use the analogy of mixing red and blue paint to get purple paint. You cannot unmix the paints to get back the original colors. What the experiment revealed was the opposite and it confirmed what is now called particulate inheritance or that the factors for a phenotype like flower color are inherited together and do not disappear but one factor, the dominant factor tends to cover up the recessive factor. In modern terms, what confers the trait for flower color is a gene and it is genes that determine phenotypes and there are two or more versions of genes called alleles and from the breeding experiments there are alleles for flower color or genes for flower color comes in two forms, an allele for purple petals and an allele for white flowers and alleles for color are both dominant (purple) and recessive (white). The genes for flower color are passed on from parent to offspring. When pollen from a purple flower plant is crossed into the ovum of a purple flower plant, what is being transferred is genes from the male component into the female component of the pea plants with only purple flowers and the first generation will have inherited the same alleles for purple petals or that the offspring will be homozygous but when alleles with purple flowers combine with alleles with white petals the offspring will be heterozygous.

 

Every gene has an allele which are passed from one generation to the next. These were the results observed in the experiments conducted by Mendel. The resulted were published and sent to an biology journal but it made little impact since for one thing Mendel applied mathematics notably statistics into his work and few scientists took the use of quantitative methods in biology seriously. Needless to say his work was not appreciated until around 1900 when his results were independently discovered by three scientists and once it was realized that Mendel’s results was the only explanation for how traits were inherited, it was then that the science of genetics became established. In addition to study of pea plants , other organisms with easily observable phenotypes were also studied and one organism, other than pea plants, which helped further established genetics was the study of the fruit fly.

 

 

                                                      Flies and Chromosomes

 

Mendel assumed and was later proven correct that the factors of inheritance, the genes, are discrete and are inherited from both parents and that each gene comes in alleles for each phenotype. In the history of science such as biology one investigation leads into another set of investigation in which one question such as are there patterns governing how physical traits are inherited was undertaken and indeed there are patterns of traits being inherited from parent to offspring. When genetics became a science, other related investigations resulted into another set of questions such as: Where do the variations that are passed from parent to offspring come from? Is there a structure that can be found which causes variation? How are these structures inherited? These structures responsible for variation, or genes, were first targeted by inference in Mendel’s experiment then with improvement in microscopy along with techniques such as staining tissues in organisms at each part of their life styles such as from egg to adult, could scientist answer the question of the source of genetic variations and this lead to the trail of the source of variation with the cell itself but the pace quicken with studies of the fruit fly. Another inference that resulted from fruit fly studies is that the gene, which comes in alleles , are present in substructures of cells , the chromosomes and not only did experiments confirm that genes are discrete units of heritable biological information but it was possible to link each gene on each chromosome to the observed phenotype.

 

A fruit fly. The study of traits are inherited from parent to offspring were found to be the result of heritable units of biological information or genes and it was found that each gene for whatever trait observed in fruit flies could be located on regions in chromosomes. (John Tann)

A fruit fly. Heredity or the study of traits  inherited from parent to offspring were found to be the result of heritable units of biological information or genes and it was found that each gene for whatever trait observed in fruit flies could be located on regions in chromosomes. (John Tann)

 

It was the biologist, Thomas Morgan, who established the experimental work on fruit flies and through careful breeding, he was able to infer a link between chromosomes and genes. It started around 1910 when in a population of fruit flies, something happen in one individual and it was Morgan whose experiment revealed how traits are inherited but an unexpected thing occurred that went beyond Mendelian principles of inheritance and ultimately lead to the fact that genes are inherited in chromosomes.

 

One individual had white eyes and it was a male fruit fly. Morgan crossed the white eyed male with a normal, red eyed female and the first generation all had red eyes so the white eye trait is recessive and red eyes are dominant. Also in the first generation both male and female flies had red eyes so this experiment revealed that red eye color is dominant. Like Mendel, Morgan repeated the experiment for producing the second generation and more than half of the second generation had red eyes but only a minority of flies had white eyes so the breeding experiment revealed that eye color is a Mendelian trait and red and white eyes are the result of two alleles of the gene for eye color but Morgan noticed a pattern: It was the linking of a visible trait, eye color, to one of the chromosomes that determine the sex of the fruit fly or more simply that fruit flies with the white eyes are males.

 

This suggests that if male fruit flies only have white eyes then somehow the chromosome that determines maleness in fruit flies happens to carry the allele for white eyes and only through males does that particular allele are inherited. If genes are inherited so are the corresponding chromosomes. Even if male fruit flies carry white eyes can female fruit flies express the white eye allele? Using what is called a testcross, Morgan crossed a female fruit fly of the first generation with the original male fruit fly that was present in the parental part of the breeding procedure and the offspring did reveal both male and female fruit flies with white eyes. Thus, Morgan revealed that an allele can be inherited through on of the sex chromosomes or the chromosomes that determine the sex of the flies ( the gender not the act!).

 

The gender of organisms that reproduce sexually such as the fruit flies as well as pea plants are determine by a specific pair of chromosomes, sex chromosomes, or in the case of insects and in mammals, the X and Y chromosomes. A pair of X chromosomes will result in a female organism while an X and Y chromosome will result in a male. What the breeding experiment with fruit flies proved was that certain traits present in one sex, such as white eyed males, are only present in one of the sex chromosomes, which is the X chromosome so the allele for white eyes are only found in the X chromosomes but are not present in the Y chromosomes which explains why the white eyes are observed in males but not in females.

 

 

 

 

 

With these experiments and other similar breeding experiments, genes and their alleles are inherited through both sets of chromosomes , those that determine body structure and function and the other set , for the sex. It was experiments like these that paved the way for the Modern Synthesis which combines genetics and evolution and it did answer Darwins’s original question : Where did the variations come from? The variations in a population are present in genes which are located in regions of chromosomes called loci and an organism inherits both copies of genes from the paternal and maternal organism but in each generation one allele may be dominant over another allele and since variations can occur through the process of meiosis or the halving of the number of genes forming the specific set of cells called gametes such as sperm and egg as well as the appearance of new alleles with new functions through mutations or change in genes such as the presence of a new allele that was not present in the previous generation.

 

Chromosomes from the salivary glands of a fruit fly. Using a special technique, the specific regions in each part of the chromosomes corresponding to genes can be see. It is known that chromosomes are composed of DNA and proteins and genes in chromosomes are linked to mutations in observable phenotypes but what were the genes composed of ? Are genes composed of DNA or proteins? (Image Editor)

Chromosomes from the salivary glands of a fruit fly. Using a special technique, the specific regions in each part of the chromosomes corresponding to genes can be see. It is known that chromosomes are composed of DNA and proteins and genes in chromosomes are linked to mutations in observable phenotypes but what were the genes composed of ? Are genes composed of DNA or proteins? (Image Editor)

 

 

 

But what were the genes really? What are genes made of? What is the molecular structure of genes and how does the molecular structure of each gene help in forming the visible traits? Prior to 1953, biologist began chemical investigation into two biological compounds, proteins and nucleic acids and also the study of simpler organisms such as mold and bacteria revealed a generality that all of life is composed of these two compounds. Proteins are based on 20 building blocks called amino acids and with any combination of amino acids, all the physiological processes from metabolism up to growth can result but nucleic acids which include building blocks called nucleotides which consists of four nitrogen based rings called bases, being adenine, thymine, cytosine, guanine, and uracil and when these compounds was investigated there were present in chromosomes and in cell nuclei hence the term nucleic acids but proteins were present so prior to 1944, it was believed that genes were composed of proteins, while the nucleic acids provided support so it was assumed that because of the versatility of proteins, only proteins would be the carrier of genetic information but an experiment with a strain of bacteria that caused turberculosis in mice challenged that assumption.

 

 

                                                                The Breakthrough of Bacteria

 

By focusing inward towards the chemical composition of genes, biologists could hope to zero towards how biological information is expressed but what was needed was an organism with a higher rate of reproduction and that organism is bacteria. Some strains of bacteria can easily be cultured  using agar in petri dishes and a single bacterium that can use the nutrients present in agar can reproduce into over a billion cells in over 24 hours making bacteria a great choice for genetics. However, genetics of bacteria was something of an accident. At first bacteria were investigated for medical reasons starting with the research of Louise Pasteur and Robert Koch, most human diseases were caused by bacteria and the search was on for vaccines and drugs that could specifically target the bacteria that was causing diseases and through the methods developed by Pasteur and Koch, some strains of bacteria were isolated and was found to cause a specific kind of disease such as the bacteria that caused tuberculosis for example.

 

A scientist named Frederick Griffiths was attempting to develop a vaccine for pneumonia by studying the pathogencity or disease causing ability of bacteria responsible for pneumonia in mice but in his investigations he made an important discovery that turned out to be very crucial for genetics and it resulted from investigating two different strains of bacteria that caused pneumonia in mice.

 

There are two strains of bacteria that causes tuberculosis and when grown on the surface of agar, a nutrient medium used for growing bacteria and mold, and the difference is evident to the naked eye: a strain called smooth because the colonies on the agar had a smooth appearance and another strain, the rough strain had a rough appearance. It was the smooth strain that caused pneumonia while the rough strain did not cause pneumonia.

 

Investigations by Griffith established that rough strains when injected into mice resulted in their survival since the bacteria that formed the rough strain did not cause the disease while bacteria from the smooth strain did. Suppose the bacteria from the smooth strain was heated and it was known that heating bacteria would kill not only destroy the bacteria but damage their ability to cause disease so when bacteria from the smooth strain was killed by heat and injected into mice, the mice survived. What would happen if a mixture of heat killed smooth strain bacteria and rough strain bacteria were injected into mice. In previous experiments rough strain bacteria lacked the ability to cause turberculosis while smooth bacteria subjected to high temperatures also lost their disease causing ability and Griffith injected a mixture of heat killed and rough strain bacteria into mice expecting that the mixture would not result in pneumonia. A surprising result happen and the mice that received the mixture did develop pneumonia!

 

How was that possible? In each separate experiment, injection of rough strain bacteria did not cause disease and heat treated bacteria also did not cause disease but a mixture of both resulted in disease and indeed not only did the mice exhibited the symptoms of pneumonia but all the bacteria recovered from the dead mice were smooth strain bacteria!

 

From his observations, Griffith concluded that the thermal energy of the heat was strong enough to shatter the smooth strain, prior to injection releasing a chemical compound that was then absorbed by the rough bacteria turning them into smooth bacteria and it was then that the rough bacteria became smooth bacteria.

 

The study of bacteria was of crucial importance of isolating what was then called the transforming factor because it had the ability to transform one strain of bacteria into another. Isolation of the transforming factor was identified as DNA. (NIAID)

The study of bacteria was of crucial importance of isolating what was then called the transforming factor because it had the ability to transform one strain of bacteria into another. Isolation of the transforming factor was identified as DNA. (NIAID)

 

Griffith called the released compound the transforming factor since it transformed non virulent bacteria into virulent bacteria but what was this transforming factor? Was it protein, nucleic acid or something else? The experiment proved that virulence can be inherited just like the experiments in pea plants prove that traits are discrete and heritable and also experiments with fruit flies prove also that traits can be inherited separately and so it is with bacteria but these experiments cannot prove what the chemical composition is nor can the structure of the genes be found. To do that new techniques of investigations were needed and for determining the chemical composition required a different version of Griffith’s experiment and with the rapid discoveries in another science, physics was also needed to determine molecular structure and with new methods in biochemistry being utilized along with techniques borrowed from microbiology, was it then possible to isolate that heritable factor whether it was Griffith’s transforming factor or Morgan’s genes and that begin also with a shift in emphasis involving bacteria as disease causing agents to bacteria as a model organisms  for how life in general expresses genetic information. One experiment which was a version of Griffith’s experiment but with some modification and the result of that experiment was surprising in its implication but once investigations of that experiment were confirmed then there was no doubt that further investigations would culminate in a major breakthrough which not only provided genetics with a secure foundation but it would answer Darwin’s crucial question, where do variations in population come from? To do that would require zeroing in on the target which is the gene and what genes are made of and this was accomplished by a team of three scientists and their results were the most surprising at the time of course.

 

                                                          The Breakthrough of 1944

 

To understand the structure and function of genes and if genes are to be understood as the unit of heredity, it was necessary to simplify the investigations by studying genes by first using prokaryotes since prokaryotes can easily be cultured in the laboratory and isolation of polymers such as proteins and nucleic acids were easily done. Since all of life is composed of proteins, it was then reasonable to assume that genes and hence chromosomes would be composed of proteins after all proteins are composed of twenty amino acids and a sequence of amino acids was assumed to carry more biological information compared to nucleic acids which consisted of a phosphate, sugar, and base and prior to the three man research team of Oswald Avery, Colin Macleod, and Maclyn McCarty, it was not considered that nucleic acids would be the genetic material even though those substances were isolated from cell nuclei along with some proteins and also recall that there existed a transforming factor that turned non virulent bacteria or non disease causing bacteria into virulent bacteria but what was the transforming factor composed of ? If the chemical composition is known then can the molecular structure then be deciphered? Notice that beginning with Darwin, biological variations could be observed only at the level of the organism and with Mendel’s careful research, he could infer the presence of a heritable factor from careful studies of pea plants and later Morgan did a similar observation using fruit flies and noticing that a particular trait, white eyes in male fruit flies which can be passed on to future generations of males with white eyes and by linking that trait of white eyes in males to a gene on a Y chromosome, was it possible to link any trait caused by an allele to a chromosome, whether a sex chromosome or autosomal chromosome or the chromosomes that carry genes for body structure and function. The question then remains: What are the genes made of? It was the experiment of Avery, Macleod, and McCarty that proved that the genes are composed of nucleic acid and in addition another independent experiment that also used microorganisms confirmed that DNA is the hereditary substance and once scientists began to accept that it is DNA that is responsible for heredity, the stage was set for the most important breakthrough: The structure of DNA and how information is stored in DNA and passed on to one generation to the next.

 

The three man team of Avery, Macleod, and McCarty proceeded by doing a version of Griffith’s pneumococci experiment where they repeated Griffith’s experiment  by culturing the strain of bacteria that caused pneumonia but no mice were used. What was different in this experiment was that the use of enzymes or protein molecules that speed up biochemical reactions were used as tools to isolate the transforming factor. In this case, enzymes that lyse or break down polymers into their constituent monomers or building blocks were used in this experiment. Three kinds of enzymes were used which are proteases or enzymes that breakdown proteins, RNase which breakdown RNA and DNase the enzymes that breakdown DNA.

 

Smooth form are what cause pneumonia in mice as well in humans so beginning with the smooth strain, the strain was heated then homogenize or breaking it down into its molecular components. Once all the bacteria were reduced to molecules, the next step was to add each enzyme separately that is one test tube of homogenized bacteria received protease, another test tube of homogenate received RNase, and another received DNase. After the treatment, each separate sample was added to culture vessels with rough strain bacteria and also recall that in the Griffiths experiment, rough strain doesn’t have any virulence. By adding the treated homogenate into rough strain bacteria, there will be either transformation or not since rough bacteria will pick up whatever transforming factor there is and the purpose of the addition of the enzymes will selectively destroy the molecule that is the transforming factor and knowing what each enzyme destroyed and observing which vessel had transformed bacteria allowed the three scientists to pinpoint what the transforming principle was made out of.

 

It was assumed that genes are composed of proteins so if protease is added to the homogenate and if the hypothesis that genes are proteins is correct, then once the homogenate with protease was added to the smooth strain bacteria and if the transforming factor is a specific set of proteins which make up genes , then after addition of protease which breaks down all proteins including the genes which were assumed to be made of proteins, there would be no transformation of rough strain bacteria into smooth strain bacteria. The result? There was transformation of rough strain into smooth strain! This came as a surprise since if genes and hence the transforming principle are composed of proteins then after treatment with proteases, there would be no transformation but transformation after the last part of the experiment was done. This narrowed it down to the nucleic acids so is RNA, a nucleic acid the transforming principle. The procedure was repeated for RNA and transforming did occur so the final choice was DNA and when DNA was treated with DNase, that prevented transformation in the last procedure. Chemical analysis of the transforming principle revealed that it was indeed DNA that was responsible for transformation and from the experiment not only did it proved that it was DNA that transforms rough strain into smooth strain but generally DNA is the molecule that carries genetic information and from this conclusion genes are composed of DNA. When the results were published, most biochemists and geneticist were not quick in accepting the results until they had the expertise of doing the experiments for themselves and finding that Avery, Macleod, and McCarty were correct in proving that DNA is the hereditary substance despite the reluctance of most scientists to accept that conclusion. It would take another experiment that combined microbiology and biochemistry to finally convince biologists that DNA is the genetic material and this involved viruses of a kind that infects bacteria called bacteriophages.

 

                                                   Viruses Provide the Ultimate Proof

 

What are bacteriophages? Bacteriophages are viruses that infect bacteria and in 1952, an ingenious experiment was performed by Alfred Hershey and Martha Chase which determined whether it was DNA or protein that is responsible for the production of viruses. In order to tell difference between protein and DNA, a technique was used to differentiate between DNA and protein and that is the use of radioactive isotopes which can easily be detected. Every atom of a given element has an isotope and they are atoms with the same number of protons and electrons but with different number of neutrons in the nucleus. Isotopes with extra neutrons tend to be radioactive and a isotope that is radioactive and in a molecule can tag the molecule so two isotopes were used for both proteins and nucleic acids, specifically DNA. Proteins which as you know are composed of 20 amino acids and some of the amino acids have sulfur and since it was known that bacteriophages are composed of proteins, including amino acids that have sulfur, there is a radioactive form of sulfur called sulfur 35 so any sulfur 35 atoms would be incorporated into the proteins of bacteriophages. For DNA, it is composed of nucleotides and one of the nucleotides is a phosphate which as you have correctly guessed has phosphorous. A radioactive form of phosphorous phosphorous 32 was incorporated into the DNA of the bacteriophages. With these two different radioactive atoms that could distinguish between DNA and protein allowed Hershey and Chase to determine whether it was DNA or protein that was responsible for the virus’s ability to produce more viruses.

 

 

 

The first part of the experiment consisted of growing E.coli growing in a medium with sulfur 35 and in a separate batch, E.coli  was grown in medium with phosphorous 32. As the viruses were infecting bacteria, populations of bacteria in the batch with sulfur 35 were taking up the sulfur 35 and adding those atoms into their protein molecules and in the process of viral replication, the viruses were adding the sulfur atoms into the protein shells while bacteria growing in phosphorous 35 were incorporating phosphorous 35 into their DNA and likewise it is the same for the bacteriophages.

 

Next, populations of labeled bacteriophages were transferred into another batch of  E.coli  but without any radioactivity and also in another batch of non radioactive  E.coli . This was to ensure that after infections, it was the bacteriophages that carried radioactive atoms. A bacteriophage consists of both DNA and protein so after a generation of phages were grown with unlabeled bacteria, the generation of phages that resulted would have both sulfur 35 and phosphorous 32. Only proteins that would make up the virus would have the sulfur 35 while the DNA would have phosphorous 32 and also recall that previously scientists such as Griffith and Avery found that there was a transforming factor that could change microbes from one form into another and Avery and his team concluded that the transforming principle is DNA. After the phages became radioactive it was then easy to distinguish between the polymers since proteins and DNA would have taken each isotope separately. How to distinguish which part of the virus was the transforming factor?

 

To determine whether it was protein or DNA as the transforming factor, viruses and then molecules would need to be separated from one another and that was a two step process. First, using a kitchen blender, radioactive viruses were separated from cells and those viruses that were separated formed a fluid called the “ghost” and in the second step, was centrifugation and that destroyed the infected bacteria forming a solid pellet. Each sample after the two part process of centrifugation was then analyzed. By analyzing radioactive sulfur and phosphorous could Hershey and Chase identify which polymer was the transforming factor or what it was that allowed viruses to reproduce when infecting bacteria.

 

The results? Each sample consisted of a liquid and solid. The liquid consisted of proteins that formed the phage while the heavier solid, the pellet, consisted of DNA including DNA of phages still in the bacteria. It was found that only sulfur 35 was detected in the liquid and very little of it was in the solid and in the liquid only and recall that previously there was still skepticism that DNA was proven to be the genetic material but if it was true that proteins are the genetic material then the observations should indicate that there would be sulfur 35 in the pellets but very little sulfur 35 was detected in the pellets and plenty of sulfur 35 in the liquid so the results narrowed down to the possibility that it is the DNA is what carried the genetic information for producing viruses, so examination of the phosphorous 32 revealed that the DNA was in the pellets and in the process of bacterial infection, DNA from the phages is injected into the cells where it could cause the cells to produce phages with both DNA and protein.

Model of a bacteriophage. These viruses only attack bacteria and are composed of both DNA and protein. It was the study of phages that scientist Alfred Hershey and Martha Chase proved that viral reproduction could only be caused by viral DNA.(Pascal)

Model of a bacteriophage. These viruses only attack bacteria and are composed of both DNA and protein. It was the study of phages that scientist Alfred Hershey and Martha Chase proved that viral reproduction could only be caused by viral DNA.(Pascal)

 

 

The conclusion from the experiment proved that it is DNA, not protein that carries genetic information and this experiment together with the Avery experiment both confirmed that DNA is the genetic material responsible for carrying the information on how an organism functions and somehow if DNA is the genetic material then previously it was shown that traits are passed from one generation to the next so by the early 1950’s experiment like these convinced biologists that DNA is the molecule that carries genetic information. Investigations narrowed down from visible phenotypes being transmitted to locating the part of the cells of organisms that housed chromosomes and chemical analysis revealed the composition of chromosomes to be nucleic acids and proteins but if chromosomes carried the genes then what were genes composed of and how does genes carried genetic information? In separate experiments using bacteria then viruses confirmed that genes are composed of DNA but if that was true, then how does the molecular structure of DNA carry biological information and how does that information get passed on from one generation to the next? To understand the molecular structure required two approaches. One approach in understanding how and why atoms form molecules required a new way of thinking about matter and energy at a fundamental level and the second approach involved an important experimental technique that could determine how molecules are structured and by examining the structure of DNA was it possible to answer the question of where in populations does the biological variation necessary for natural selection to work, a question asked by Darwin but was unable to answer was finally answered and it was made possible not by biologists but the stage was set by a brilliant physicist.

 

 

                                                               A Physicist Paves the Way

 

In the field of physics, a new view of nature was formulated that not only did it give a correct view of nature but its implication were nonetheless strange and counterintuitive, and that field of physics which would eventually be helpful in understanding the molecular structure of DNA is quantum mechanics. What is quantum mechanics? Quantum mechanics studies matter and energy at the most fundamental and one of its basic assumption which turn out to be true is that energy is discrete and within atoms, there are no continuous exchange of energy but only levels of energy are permitted. From 1900, a physicist Max Planck, in an effort to explain a riddle regarding how hot bodies emit energy made an assumption that was pretty radical within the established view of classical mechanics which assumes that energy is continuous and in an effort to understand what theory predicted about how energy is emitted and absorbed, Planck made the assumption that energy comes in discrete units called quanta and even though it provided the answer for the riddle regarding heat emission and absorption, the assumption was so radical that not even Planck himself could accept it. He though that the constant, h, or Planck’s constant which had a very small but finite value and was later confirmed by experiment, but prior to experimental confirmation he assumed that it was something of a mathematical fiction and that it had no significance in reality whatsoever. Five years later, Albert Einstein accepted Planck’s assumption that his constant that allowed energy to be in discrete form, and he used to solve a puzzle not with heat absorption but with a physical phenomenon called the photoelectric effect where electrons in metal are released forming an electric current when light of various frequencies shine on metals. Prior to Einstein, this phenomenon was already investigated but it was a puzzle about why light of differing frequencies should release electrons or when blue light which has a high frequency than red light which has a low frequency is unable to do so. Einstein provided the answer by assuming that light, a form of energy, is quantized or it comes in quanta of energy that depends only on frequency. Light quanta with high frequency when multiplied by Planck’s constant has high energy while red light with low frequency has low energy and with high energy blue light can release electrons from atoms in metals but red light is unable and physicists later confirmed Einstein’s prediction while confirming the reality of Planck’s constant, a constant that is central to quantum mechanics.

 

In addition to energy, matter is composed of atoms with a central nucleus of protons and neutrons and surrounded by electrons. That model was first developed by J.J Thomson who found that atoms are composed of electrons and working with Thomson, was the British-New Zealand physicist Ernest Rutherford. Using radioactivity as a tool to probe the inside of atoms, he found that the nucleus is positively charged, small in comparison to the atom, which is mostly empty space and surrounded by a cloud of electrons. This model is the well known solar system model of atoms but there was a problem with this model. From the point of view of classical mechanics, it would be an unstable atom since electrons in orbit are accelerating and since they carry negative charge, an accelerating charge releases energy and if electrons were orbiting then they would end up losing energy as a result and atoms would collapse. Of course this does not happen, so it seems that another field of physics must be needed to explain the stability. Also atoms emit energy in the form of spectral emissions which are colored lines of energy that span from red to violet. Classical mechanics can only give a partial answer to how atoms emit spectral lines as well as how atoms are stable. The only correct explanation was to use quantum mechanics and that answer was solved by Danish physicist Neils Bohr who applied quantum theory to the atom and the assumption is that if energy comes in discrete units then the energy of electron motion in the atoms cannot take continuous values but must have discrete values that is the energy of orbits are discrete starting with the lowest orbit called the ground state, which has the lowest level of energy and even though the electron can orbit the nucleus it emits no energy when in orbit. Atoms can only emit energy by jumping from a higher orbit to a lower orbit giving of a quanta of light in the process and likewise to jump from a low to high orbit requires quanta of the right amount of energy.

 

With the application of quantum theory to the atoms, it was able to explain perfectly the emission and stability of atoms and later Bohr’s model was confirmed to be correct so quantum mechanics began to mature in the 1920’s and this field of physics had great success in forming models that could be tested. One aspect of quantum mechanics that is so strange yet was proven to be true is that particles have a wave aspect while light, a wave phenomenon also has particle aspects. This is known as the famous wave particle duality and this became the basis of a field of quantum mechanics called wave mechanics and this was established by the Austrian physicist Erwin Schrödinger who devised the equation that is based on wave particle duality and once the equation is solved, it is possible to get back the energy level of atoms and the result is that quantum mechanics could make predictions that could be verified. Also quantum mechanics greatly benefited chemistry and with quantum mechanics, how atoms could bond to form molecules was finally solved. It takes a certain amount of energy for atoms to come together to form strong bonds called covalent bonds and the same amount to break them.

 

Since quantum mechanics could make predictions about the behavior of atoms that were confirmed to be true, in order to study atoms, it takes energy to probe atoms. Radioactivity was used to probe the atom’s nucleus and one of the predictions of quantum mechanics is that atoms are small because of Planck’s constant and to study atoms involves bombarding them with energy of a given frequency. The higher the frequency the more energy there is to study the inside of atoms. Atoms that form crystals were also being investigated not with radioactivity which can only probe the nucleus but to understand how electrons in atoms form bonds in crystals required the use of x-rays and this technique was first used to examine how atoms are arranged in crystals. X-rays are useful because the wavelength which is the inverse of the frequency is of the same size as the electron orbit and if the orbit is slightly smaller than the x-ray wavelength, the x-rays will bounce or diffract, much as bacteria can be seen under the microscope because their small size is slightly bigger than visible light wavelengths and so the bacteria diffracts the light making it possible to see them in the microscope.

 

If a beam of x-rays bombards a crystalline substance, the atoms will diffract the x-rays in various directions and different atoms have different sizes and so will produce a different pattern of x-rays. This is the basis of the technique called x-ray crystallography and it turn out to be the utmost importance of studying the structure of molecules. By the late 1940’s this technique became indispensable in studying biological molecules including the genes and by studying the molecular structure of genes would it then be possible to understand the hereditary mechanism.

 

It was Schrödinger  who because of his expertise in a  field of physics that he helped contribute which is quantum mechanics. If quantum mechanics can explain atomic stability and give chemistry a firm foundation and chemistry notably biochemistry was rapidly targeting the molecules that could carry out vital life processes including the molecules that were responsible for heredity then it was not unreasonable to use quantum mechanics to give a model of a molecule that is stable, able to replicate, carry information from one generation of organisms to the next. The other insights Schrödinger was aware was the findings in genetics and in February of 1944, Schrödinger presented his ideas in a book, What is Life? where he makes an argument for a kind of molecule that is found in living organisms that is responsible for heredity.

 

First, he assumes that quantum mechanics could provide an explanation for stability of molecules. His reasoning is that starting with classical mechanics and thermodynamics, for simple systems such as a gas, a gas has billions upon billions of molecules of the same kind and at thermal equilibrium where nothing happens, there are fluctuations which form quickly but die quickly. The larger the number the fewer the fluctuations. A molecule such as a gene which was found to consist of 300 atoms would have the opposite problems. A system of 300 atoms would experience so much fluctuations as to have it destroyed. That would be problematic according to Schrödinger because genes which consists of 300 atoms would not only have to be stable but must be able to carry information from one generation to the next. It was already shown that genes are not only static structures but can change or mutate into a different form. How is that possible? It was because of quantum mechanics that a gene is stable because the atoms are covalently bonded and a covalent bond is much strong than the thermal energies needed to disrupt but not too strong as to prevent mutations from occurring.

 

What would be the characteristic of a hereditary molecule? Inorganic crystals such as quartz are composed of atoms that have a fixed pattern; the pattern is the same or repeats in three dimensions. Obviously the molecule cannot be a gas since in a gas all the atoms are randomly moving so the molecule which  Schrödinger called an “aperiodic crystal” since the molecule would not only be a solid because of covalent bonds but the pattern would not be repetitive because  a repetitive pattern carries little information or the only information is knowing which atoms are adjacent to one another. This molecule would need to use information in how an organism functions as well as how the molecule will carry information on how to replicate. Since an organism ranging from bacteria to humans carry a lot of information of a different kind biological information which for bacteria for example whether it well utilize oxygen and how to do it or for the human, how a set of protein molecules determine eye color to how cells that form the heart coordinate to perform the vital function of pumping blood. Since that is a lot of information, it would need to be compressed within a gene and the gene carrying biological information would be aperiodic that is the sequence of atoms in the gene would not repeat but would vary and that would carry plenty of information.

 

 

Schrödinger was correct in assuming that the aperiodic crystal or gene would vary enough to carry and with an ability to transmit information and that genes would be located on chromosomes where the hereditary information would be stored. He was incorrect in assuming that the genes would be composed of proteins. We may laugh at it today for making such a mistake but back then the paradigm was that genes were composed of proteins while nucleic acids were seen as the support. In the same year, 1944 that Schrödinger’s book was released, Avery and his colleagues confirmed that DNA is the hereditary molecule and later, Hershey and Chase also confirmed that DNA is the hereditary substance. By the early 1950’s the consensus is that DNA is responsible for heredity but if true then what is the molecular structure of DNA and how does it relate to its function of heredity? There were techniques in addition to analyzing what it is composed but to find the structure of DNA, it was necessary to use x-ray crystallography to determine the structure and beginning in 1947, the biologist William Astbury began the first x-ray probe of DNA which revealed that it had a structure and the pace quickened when English biologists Maurice Wilkins and later Rosalind Franklin used improved techniques of analyzing the structure of DNA and the result about the DNA molecule was peculiar to say in the least. There was something unusual about this molecule. It was not like protein molecules which because of being composed of amino acids are linked into a chain and forms a 3-dimensional structure in cells but a DNA molecule is linear, not like a mature functioning protein such as an enzyme and if scientists were to accept the fact that DNA is the hereditary molecule then there had to be a way of understanding the x-ray results of DNA and it was not enough to understand the diffraction patterns. Another method was to understand what DNA is composed of and that is nucleotides which are composed of phosphate, a sugar called deoxyribose, and four nitrogen compounds called bases, adenine, thymine, cytosine, and guanine. Could the pattern of nucleotides that compose DNA explain the peculiar results and if it did, how will the structure relate to the function of DNA as the hereditary molecule? It took a team of two scientists with the courage to follow the evidence where it lead and where it lead with these men was that a new paradigm shift as vital and profound as Darwin’s On the Origin and with the results biology now had a new foundation for how life is relate, how it functions, and even benefits for humanity. These men became well known for their discovery which prompted further investigation into the molecular nature of the heredity mechanism, and the two scientists that succeed in the quest were American biologist James Watson and Englishman Francis Crick.

 

                                                            Discovery of the Double Helix

 

At this point, we must emphasize where all of this is leading: Questions regarding heritable biological variation that is where does it come from and can it be located in some physical structure and if so how does the physical structure code for biological information? Beginning with Darwin, he adopted a new form of thinking which is population thinking where individuals differ in phenotype which is heritable in a population. He knew of the reality of variation but did not know about what cause it. Mendel also started with organisms and it was investigations of heritable discrete traits that lead him to the idea of factors now called genes. Further investigations of fruit flies by Morgan and his colleagues revealed that genes are located on chromosomes and that a corresponding change in gene results in a mutation and genes and chromosomes are composed of proteins and DNA. You will notice that starting with Darwin and culminating with Watson and Crick, the problem of heritable biological variation was being analyzed first by observing how traits are passed on and making inferences of what unit of information was being transmitted. Then observing chromosomes and linking mutations within regions of genes that correspond to specific regions of chromosome, could visible mutation be observed and a combination of biology and chemistry was needed to determine whether it was DNA or protein that made up genes. This approach of analyzing a problem by breaking it down into simpler components is the method known as reductionism or understanding something by breaking it down into its individual components and by observing how each component functions could it possible in principle, if not always in practice, to see how that component could effect large changes. Biology notably genetics and biochemistry were taking that reductionist approach in tackling the nature of genes which reached its climax with the discovery of the double helix of DNA. This is an example of what the theoretical physicist Steven Weinberg stated clearly of reduction as “arrows of explanations” (p.6) or beginning at the higher level, the organism, the heredity of organisms could be traced to changes in regions of chromosomes leading to the gene itself and to the molecular structure which was revealed to be the double helix. This is what I meant by reductionism in that sense and it proved to be successful as molecular biology was concerned.

 

The next step was to find out how the molecular structure is related to the function of DNA and the to find the structure required x-ray crystallography. From the late 1940’s to the early 1950’s x-ray crystallography was sophisticated enough to unravel DNA’s molecular structure. Find out what the structure is and the problem of heredity would be solve while answering one of Schrödinger’s question about life as well as Darwin’s question about heritable variations. Beginning with the work of English physicist turned biologist Maurice Wilkin and shortly thereafter he was joined with Rosalind Franklin and the team produced high quality x-ray diffraction patterns of  DNA but with two forms of the molecule of DNA, and A form which has a different structure because of lack of water and a B form which forms in the presence of water and DNA is found in the cell nuclei which is a aqueous environment anyway and if a model could be developed to explain DNA as the molecule that could carry information from one generation to the next then x-rays of the B forms would need to form. Although Wilkin and Franklin were making progress in obtaining x-ray images of DNA there progress was short lived mainly because of conflicting views on approaching scientific problems regarding on how to analyze and construct a model to explain the results of the x-ray photographs so they didn’t carry their research any further.

 

It was left to James Watson and Francis Crick to solve the puzzle.

 

Watson was influenced not by studies in biology but by Schrödinger’s little book and likewise Crick was interested in the problem as well since he,like Watson, read Schrödinger’s work on the structure of the gene and together the two would end up constructing models of what the molecule of DNA would be like based on previous research in biochemistry of nucleic acids, and findings in genetics which shifted from classical or Mendelian to molecular. The chemistry of DNA was well understood and it was known that adenine bounds with thymine and guanine binds to cytosine so this fact was taken into consideration. Both adenine and thymine are base pairs and likewise so are guanine and cytosine. If adenine can pair with thymine then thymine can bond with adenine and likewise cytosine can bond with guanine and guanine with cytosine. Each base pair is bonded to a sugar, deoxyribose and the sugar is bonded to a phosphate. Now questions regarding the structure: What is the structure of a sequence of phosphate bonded to deoxyribose sugar bonded to each base pair? Is it a single polynucleotide or many nucleotide strand. It is unlikely to be single stranded because for each base such as adenine, there is another base to bond to, thymine which is bonded to another sugar in another strand so the molecule had to consist of two strands of polynucleotides and using data from chemical analysis such as the size of each nucleotide Watson and Crick began to build models using metal and wires into a model of a DNA molecule where each component would represent a nucleotide (there were no computer simulations back then).

 

Adenine bonds with thymine and guanine bonds with cytosine. This was known as Chargraff’s rule after the Austrian biochemist, Erwin Chagraff who discovered this rule and previously prior to the Oswald experiment there was a model of the structure of nucleic acids which was called the tetranucleotide hypothesis put forth by biochemist Phoebus Levene and in his model, there is a sequence of phosphate, sugar , base with the four bases forming a repeating pattern of adenine, thymine, guanine, and cytosine all in repeating order from beginning to end. It was this hypothesis that convinced biologists that DNA could not be the genes despite being isolated from cell nuclei and a repeating pattern would not carry any useful information but after the two experiments confirming that genes are composed of DNA and would have to be the genetic material responsible for heredity, DNA would not consist of a repeating pattern of bases but a varying pattern of bases and in the tetranucleotide hypothesis, the four bases are abbreaviated A for adenine, T for thymine, G for guanine, and C for cytosine would have this repetitious pattern.

 

 

ATGCATGCATGCATGCATGC…..

 

As you can see a repeating pattern carries little information. It was the work of Chagraff and colleauges which proved that the four bases are not constant but variable from each organism so there is variation in each DNA molecule and it was also discovered by Chagraff that A pairs with T and G pairs with C so one strand of a polynucleotide with the sequence of bases

 

TAGCGGTATAAGCCCTGAGGC….

 

would have a corresponding sequence of bases in another polynucleotide chain…

 

ATCGCCATATTCGGGACTCCG…

 

This fact was taken into account for building models of a DNA molecule. Also the molecular structure of each base, deoxyribose, and phosphate were known so that was also incorporated into the models. X-ray photographs provided a crucial clue and in the B forms or DNA with water, the photos revealed a peculiar structure that I mentioned. It could be assumed that the two polynucleotides of the B form were wound together and held by chemical bonds. This structure would be none other than a double helix a fact that was noticed by Watson an Crick. Each polynucleotide molecule would be wound together like the railways of a spiral staircase which the x-ray photos were indicating. Would a double helix model be adequate to explain how DNA is structured?

 

The idea of a helical structure of a biological polymer was not a novel idea to have been thought of by Watson and Crick. Molecules like protein were demonstrated to have a helical structure and it was found by the brilliant physical chemist, Linus Pauling and Pauling played a crucial role in the science of chemistry by incorporating quantum mechanics into how chemical bonds form and indeed it was Pauling who gave a satisfactory explanation of chemical bond using quantum principles notably of covalent bonding. Pauling shifted his work from physical chemistry to biochemistry and he tackled a problem regarding the structure of polypeptides or long chains of amino acids and some chains of amino acids can form helix which was predicted by Pauling and was later confirmed to be true. Also Pauling got interested in the connection between biochemistry and genetics and he along with colleague Robert Corey began to tackle the problem regarding the structure of nucleic acids. If protein molecules can exist as helices then it was not unreasonable to assume that DNA is a helix but Pauling and Corey’s model gave a model of a DNA molecule as a triple helix with the bases outside of the phosphate-sugar molecule. Watson was aware of that publication and found that this model could not reasonably explain the x-ray diffraction patterns and chemical analysis of DNA. The only valid explanation is that the sequences of bases are variable and Chargraff’s rule was found to have no exception and that the bases are found inside the sugar phosphate chain while the sugar phosphate chain is outside the molecule. The x-ray photographs revealed that DNA is a double helix not a triple helix and it was also found that there is a weak chemical bond between the two bases or hydrogen bond which is weak enough to allow the two polynucleotide chains to separate but also strong to hold the chains together.

 

The molecular structure of DNA. A DNA molecule is composed of two polynucleotide chanins, phosphate and sugars covalently bonded to one another and two base pairs adenine and thymine bonded to one another and guanine and cytosine bonded to one another and the two base pairs are located inside the helix. It was the model of the double helix devised by James Watson and Francis Crick that was proven to be correct not only giving an answer to the puzzles of heredity but also finally answering Darwin's question. (Enzymlogic)

The molecular structure of DNA. A DNA molecule is composed of two polynucleotide chanins, phosphate and sugars covalently bonded to one another and two base pairs adenine and thymine bonded to one another and guanine and cytosine bonded to one another and the two base pairs are located inside the helix. It was the model of the double helix devised by James Watson and Francis Crick that was proven to be correct not only giving an answer to the puzzles of heredity but also finally answering Darwin’s question. (Enzymlogic)

 

 

 

All the evidence used by Watson and Crick lead to the conclusion: First, DNA not protein is the genetic material with the ability to carry information and pass on to future generation of offspring whether of bacteria, fruit flies, monkeys, and humans. Next DNA consists of bases that form pairs with opposite bases in another polynucleotide chain. Hydrogen bonds exist between bases, and x-ray diffraction revealed that only two polynucleotide chains wind together because of the hydrogen bonds between A and T and C and G. This lead to the conclusion: Genes which are hereditary units are composed of nucleic acids and the nucleic acid, deoxyribonucleic acid, or DNA for short is a molecule that exists as two polynucleotide sequences of variable amounts of bases that are A,T,C,G which pair with one another and form a double helix. In other words, DNA is the double helix.

 

As a double helix, Watson and Crick were quick to point that because DNA in cells is a helix, the fact that it is a helix means that it has the ability of replication or that a single DNA molecule can make two copies and that two copies can make four copies and so on.  DNA is the only molecule with this ability and no other polymer could do such a thing. The copying mechanism is nearly perfect since the sequence of bases may be identical to the original but mistakes can occur such as the addition or deletion of a base pair which is a mutation so a gene which is a DNA molecule that codes for an important molecule, mainly proteins, will carry pass on the information. A protein molecule such as the pigment for red eyes in fruit flies will be inherited and indeed populations of fruit flies with red eyes are inherited and that is because the gene for the red eye pigment is encoded into the sequence of bases of DNA and as a double helix that information is stored and copied. Once in a while, the sequence will change and if the change is slight, another version of the protein, a molecule of eye pigment that is white, will result and will show up in one of the offspring.

 

You will notice because of the approach of using reductionism into biology in answering Darwin’s question of the source of variation, this resulted into the discovering the molecular structure of genes and eventually everything that seemed separate such as Mendelian genetics and Darwinina evolution by natural selection began to come together through the Modern Synthesis of evolutionary biology and since genetics was undergoing a rapid transformation the DNA structure that defines the gene not only supported Darwin’s theory of evolution but the double helix model added more related investigations such as what is the exact copying mechanism of DNA? How does the information get translated into proteins. Although I will not go into detail about the discoveries that followed but the discoveries about how DNA is copied, how the genetic code or rule for how sequences of three bases pair with amino acids, and how genes express their information into sequences of amino acids were eventually answered all of which were based on the double helix model.

 

                                                                      Conclusion

 

You can see that when using the scientific method in investigating the source of biological variation by taking up the challenge posed by Darwin’s question regarding the origin of biological variation scientist were lead to the definition of the gene that is now accepted based on scientific facts that was obtained from years of investigations using new techniques in biochemistry and molecular biology and here is the definition of the gene: A gene is a heritable unit of information composed of DNA and each gene consists of variable sequences of four bases, adenine, thymine, cytosine, and guanine. The variable sequences carry information for the sequences of amino acids for proteins. Any sequence of bases in a gene can result in any sequence of protein whether the protein may be an enzyme, a carrier protein such as hemoglobin, or a antibody for example. The structure of a gene, a double helix can replicate into many identical copies and the gene has information for its replication using  a specific set of enzymes, DNA polymerase or enzymes for replication. A change in the base sequences resulting in a different copy of DNA is known as a mutation and mutations can be harmful if it affects the fitness organism, neutral or mutations that are neither harmful nor helpful, and beneficial if the new phenotype encoded by the mutant gene confers an heritable advantage. Genes express information by using a form of nucleic acids, RNA or ribonucleic acid which uses the base uracil or U instead of T and the sugar is ribose, instead of deoxyribose. RNA molecules are more functional than DNA, and one RNA, messenger RNA, carries the genetic information present in DNA towards a protein-RNA complex found in all cells called a ribosome which reads the sequences of bases in the messenger RNA three bases at a time which corresponds to a given amino acids and using another RNA, transerRNA which carries the corresponding amino acid, each amino acid is linked to another amino acid, made possible by the ribosomes reading three bases along the messenger RNA and each consecutive reading of three bases results in a growing polypeptide chain which is the protein molecule so information flows from DNA to RNA to protein. This is possible because all of life uses the genetic code which specifies that three bases or codons specify which of the 20 amino acids, some can pair with a single amino acids other can code for two to three differing amino acids.

 

In a way Darwin predicted the modern science of genetics and that was because he adopted population thinking by treating variations in a population of living organism as real and accepting it as a fact Darwin began the long and winding road to finding the source of the variation which lead through difficult scientific investigations to the modern concept of the gene that not only part of biology but also confirming Darwin’s thesis of evolution by natural selection. Such a paradigm shift is also the reason for the definition of the gene that we now know and had Darwin not accepted population thinking then it is likely that we may never reached the conclusion of the nature of genes.

 

Reference:

 

Aldridge, S (1996) The Thread of Life: The Story of Genes and Genetic Engineering Cambridge Engalnd: Cambridge University Press

 

Avery O, Macleod C, McCarty M(1944). Studies of the Chemical Nature of the Substance Inducing Transformation of Pneumococcal Types: Induction of a Transformation by a Deosryibonucleic Fraction Isolated from a Pneumococcal Type III. Journal of Experimental Medicine, 2, 297-326. doi:10.1084/jem.149.2.297

 

Avery-Macleod-McCarty Experiment. (n.d). Retrieved September 3, 2015 https://en.wikipedia.org/wiki/Avery%E2%80%93MacLeod%E2%80%93McCarty_experiment

 

Chagraff, E (1950). Chemical Specificity of Nucleic Acids and Mechanism of their Enzymatic Degradation. Experienta ,6, 201-209  doi:10.1007/BF02173653

 

Darwin, C (1859) On the Origin of Species By Means of Natural Selection or the Preservation of Favoured Races in the Struggle for Life. London, England: Murray London

 

Gene (n.d) Retrieved on August 31 2015 https://en.wikipedia.org/wiki/Gene

 

Gribbin, J.(1985) In Search of the Double Helix: Quantum Physics and Life New York, NY, Penguin Books

 

Griffith, F.(1928). The Significance of Pneumococcal Types. Journal of Hygiene, 2, 113-159. Retrieved from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2167760/

 

Griffith’s Experiment. (n.d). Retrieved September 3, 2015 , from https://en.wikipedia.org/wiki/Griffith%27s_experiment

 

Hershey, A.,& Chase,M. (1952). Independent Functions of Viral Protein and Nucleic Acid Growth in Bacteriophage. Journal of General Physiology,36, 39-56. doi:10.1085/jgp.36.1.39

 

Kamentskii-Frank, M (1997) Unraveling DNA: The Most Important Molecule. (L. Liapin,Tran.). Boston, MA: Addison-Wesley

 

Mayr, E (1988) Towards a New Philosophy of Biology: Observations of an Evolutionist Cambridge MA: Harvard University Press

 

Morowitz, H.J, Morowitz L.S (1974). Life on the Planet Earth New York, NY: Norton & Company

 

Pauling,L, Corey,R (1953). A Proposed Structure for Nucleic Acids. Proceedings of the National Academy of Science ,2, 84-97 doi:10.1073/pnas.39.2.84

 

Pierce, B.A (Ed.). (2012). Genetics: A Conceptual Approach (4th. ed.) New York, NY: W.H Freeman and Company

 

Schrödinger, E (1944). What is Life? The Physical Aspect of the Living Cell. Cambridge, England: University of Cambridge Press

 

Watson, J, Crick, F (1953). A Structure for Deoxyribonucleic Acid Nature, 4356, 737-738. (4356). doi:10.1038/17173

 

Watson, J. Berry,A (2003) DNA: The Secret of Life. New York, NY: Andrew J. Knopf

 

Weinberg, S (1992) Dreams of a Final Theory: The Scientist’s Search for the Ultimate Laws of Nature. New York, NY: Vintage Books

 

 

Photos:

 

Michael MK. Khor  https://www.flickr.com/photos/mk-creatures/12853575873/in/photolist-kzPWi8-oHTxRB-p82Xyq-85VkKC-oaQT8k CC BY 2.0

 

John Tann Drosophila immigrans https://www.flickr.com/photos/31031835@N08/14598917495/in/photolist-of4gy4-6iUS6x-nXyYr4-8We2ia-ccNAY9 CC BY 2.0

 

Image Editor 10 Drosophila Salivary Chromosomes https://www.flickr.com/photos/11304375@N07/2993343506/in/photolist-9r1ffa-edydgn-6iZ2Lj-8DMzjx-676x4k CC BY 2.0

 

 

NIAID Mycobacterium tuberculosis Bacteria, the Cause of TB https://www.flickr.com/photos/niaid/5149398656/in/photolist-q3tycZ-4a7n2U-f8aVS-4ptFBx-9y4sD6 CC BY 2.0

 

Pascal Bacteriophage https://www.flickr.com/photos/pasukaru76/16233608477/in/photolist-mAubrA-x9HdbW CC0 1.0 Universal

 

Enzymlogic DNA https://www.flickr.com/photos/101755654@N08/9735192821/in/photolist-ae1zYZ-7TqgUV-qZChgN  CC BY-SA 2.

 

Comments are closed.